dominant negative rab7 (Addgene inc)
Structured Review
![( A and B ) Affibody-chase experiments. Cells surface labeled with FITC-conjugated HER2 affibody and stimulated with soluble LAP (LAP) to stimulate α V β 6 integrin and trigger α V β 6 endocytosis, or vehicle (Control), 0- to 60-min time course. Quantitation represents cytoplasmic HER2 fluorescence intensity analysis in (A) trastuzumab-sensitive or (B) trastuzumab-resistant BT474 cells ( N = 3; 27 to 50 cells per condition), normalized to control trastuzumab-sensitive BT474 cells (0 min); scale bar, 10 μm. Two-way ANOVA with Šídák’s multiple comparison test. Image intensity increased in (B), relative to (A), due to low cell surface HER2 levels in trastuzumab-resistant cells to highlight internalization differences. ( C ) HER2 (green) and RAB5 (magenta) immunofluorescence in trastuzumab-sensitive and trastuzumab-resistant BT474 cells, treated with soluble LAP, 0 to 60 min ( N = 3; 16 to 28 cells per condition); scale bar, 10 μm. ( Ca ) HER2/RAB5 colocalization quantitation (Pearson’s coefficient ± SEM). Two-way ANOVA with Dunnett’s multiple comparison test. ( D ) Active RAB5 pull-down assays. 0- to 60-min LAP stimulation time course. Quantitation of mean RAB5 activity (pull-down eluate), relative to total RAB5 (lysate) ± SEM ( N = 3), normalized to 0-min trastuzumab-sensitive cells. One-way ANOVA with Dunnett’s multiple comparison test. ( E and F ) Affibody-chase experiments in (E) siControl Trastuzumab-Sensitive or (F) Trastuzumab-Resistant BT474 cells expressing constitutively active RAB5 (RAB5CA), dominant-negative RAB5 (RAB5DN), dominant-negative <t>RAB7</t> (RAB7DN), or mCherry vector control. Cells were surface labeled with FITC-conjugated HER2 affibody and stimulated with soluble LAP (LAP), or vehicle control (control), for 0 or 30 min. Quantitation represents cytoplasmic HER2 fluorescence intensity ( N = 3; 81 to 87 cells per condition); scale bar, 10 μm. One-way ANOVA with Tukey’s multiple comparison test. Representative images in fig. S10 (A and B). Further HER2 internalization analyses: Supplementary Results and fig. S11 (A to D). [(A), (B), and (D) to (F)] Data are arbitrary units (AU) normalized to control means ± SEM. [(A) to (F)] Statistical significance: * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.](https://pub-med-central-images-cdn.bioz.com/pub_med_central_ids_ending_with_6693/pmc11616693/pmc11616693__sciadv.adk9944-f4.jpg)
Dominant Negative Rab7, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dsred-rab7/DsRed-rab7+DN+(Plasmid+%2312662)/pmc11616693-376-26-30
Average 93 stars, based on 19 article reviews
Images
1) Product Images from "A trafficking regulatory subnetwork governs α V β 6 integrin-HER2 cross-talk to control breast cancer invasion and drug resistance"
Article Title: A trafficking regulatory subnetwork governs α V β 6 integrin-HER2 cross-talk to control breast cancer invasion and drug resistance
Journal: Science Advances
doi: 10.1126/sciadv.adk9944
Figure Legend Snippet: ( A and B ) Affibody-chase experiments. Cells surface labeled with FITC-conjugated HER2 affibody and stimulated with soluble LAP (LAP) to stimulate α V β 6 integrin and trigger α V β 6 endocytosis, or vehicle (Control), 0- to 60-min time course. Quantitation represents cytoplasmic HER2 fluorescence intensity analysis in (A) trastuzumab-sensitive or (B) trastuzumab-resistant BT474 cells ( N = 3; 27 to 50 cells per condition), normalized to control trastuzumab-sensitive BT474 cells (0 min); scale bar, 10 μm. Two-way ANOVA with Šídák’s multiple comparison test. Image intensity increased in (B), relative to (A), due to low cell surface HER2 levels in trastuzumab-resistant cells to highlight internalization differences. ( C ) HER2 (green) and RAB5 (magenta) immunofluorescence in trastuzumab-sensitive and trastuzumab-resistant BT474 cells, treated with soluble LAP, 0 to 60 min ( N = 3; 16 to 28 cells per condition); scale bar, 10 μm. ( Ca ) HER2/RAB5 colocalization quantitation (Pearson’s coefficient ± SEM). Two-way ANOVA with Dunnett’s multiple comparison test. ( D ) Active RAB5 pull-down assays. 0- to 60-min LAP stimulation time course. Quantitation of mean RAB5 activity (pull-down eluate), relative to total RAB5 (lysate) ± SEM ( N = 3), normalized to 0-min trastuzumab-sensitive cells. One-way ANOVA with Dunnett’s multiple comparison test. ( E and F ) Affibody-chase experiments in (E) siControl Trastuzumab-Sensitive or (F) Trastuzumab-Resistant BT474 cells expressing constitutively active RAB5 (RAB5CA), dominant-negative RAB5 (RAB5DN), dominant-negative RAB7 (RAB7DN), or mCherry vector control. Cells were surface labeled with FITC-conjugated HER2 affibody and stimulated with soluble LAP (LAP), or vehicle control (control), for 0 or 30 min. Quantitation represents cytoplasmic HER2 fluorescence intensity ( N = 3; 81 to 87 cells per condition); scale bar, 10 μm. One-way ANOVA with Tukey’s multiple comparison test. Representative images in fig. S10 (A and B). Further HER2 internalization analyses: Supplementary Results and fig. S11 (A to D). [(A), (B), and (D) to (F)] Data are arbitrary units (AU) normalized to control means ± SEM. [(A) to (F)] Statistical significance: * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.
Techniques Used: Labeling, Control, Quantitation Assay, Fluorescence, Comparison, Immunofluorescence, Activity Assay, Expressing, Dominant Negative Mutation, Plasmid Preparation
Figure Legend Snippet: ( A ) Trastuzumab-Sensitive Cells: GDI2 is recruited to sites proximal to α V β 6 IACs and coordinates HER2 and α V β 6 trafficking and signaling by locally modulating RAB5 activity. GDI2-mediated cross-talk between α V β 6 and HER2 affects membrane availability of both receptors, ultimately influencing migration, invasion, and TGFβ activation. ( B ) Trastuzumab-Resistant Cells: GDI2 is excluded from α V β 6 IACs, leading to dysregulation of RAB5 activation dynamics, followed by increased RAB7 activation. Consequently, HER2/α V β 6 cross-talk is impaired, altering receptor trafficking dynamics and disrupting bioavailability of both HER2 and α V β 6 integrin at the plasma membrane. This dysregulation further affects TGFβ activation, resulting in increased cell invasiveness and metastatic potential. Overall, these changes may increase the ability of cells to evade HER2 targeting drugs.
Techniques Used: Activity Assay, Membrane, Migration, Activation Assay, Clinical Proteomics
Figure Legend Snippet: ( A ) Differential gene expression data (RNA-seq) for the GDI2 / RAB5A / RAB7A / ERBB2 / ITGB6 cluster in normal breast tissue ( n = 403; light gray) and breast invasive carcinoma ( n = 1097; dark gray). Data were extracted from the TNMplot database ( tnmplot.com ). Black lines in violin blots represent the median. Mann-Whitney test. ( B ) Volcano plot showing statistical analysis (ANOVA) of RNA-seq gene expression data of patients with HER2+ breast cancer from the METABRIC cohort expressing high (Right) and low (Left) levels of ITGB6 (Q1 versus Q4). Significant genes (dark gray); nonsignificant genes (light gray); relevant genes are highlighted in purple. ( C ) Visual representation of GO terms analysis (ClueGO, cellular compartment) of genes highly and significantly expressed in tumors expressing high levels of ITGB6 (Q4). Colors represent specific merged GO term groups, node size represents the level of significance of each GO term, and clustering and edge length represent functionally grouped networks based on kappa score. ( D ) OS of patients with HER2+ breast cancer and with high (above median) expression of ITGB6 , expressing high (red) or low (black) levels of GDI2 , ERBB2 , RAB5A , and RAB7A . ( E and F ) Differential ITGB6 gene expression (gene chip) in patients with HER2+ breast cancer subdivided according to therapeutic response to trastuzumab. (E) Initial pathological complete response (responder) versus residual disease after completing therapy (nonresponder) ( n = 77 patients). (F) RFS at 5 years (responder) versus samples relapsed before 5 years (nonresponder) ( n = 24 patients). Two-sided Student’s t test. [(A), (E), and (F)] Statistical significance: * P < 0.05; **** P < 0.0001.
Techniques Used: Gene Expression, RNA Sequencing, MANN-WHITNEY, Expressing, Clinical Proteomics
Related Articles
Recombinant:Article Title: Autophagy Blockade Limits HER2+ Breast Cancer Tumorigenesis by Perturbing HER2 Trafficking and Promoting Release Via Small Extracellular Vesicles. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Primer1 of Her2 (Human): TGCTGGACATTGACGAGACAGAGT (fwd) This paper N/A Primer2 of Her2 (Human): AGCTCCCACACAGTCACACCATAA (rev) This paper N/A Primer1 of Her2 (GAPDH): CTCCTCCTGTTCGACAGTCAGC (fwd) This paper N/A Primer1 of Her2 (GAPDH): CCCAATACGACCAAATCCGTT (rev) This paper N/A Recombinant DNA DsRed-Rab7 Choudhury et al., Software:Article Title: Autophagy Blockade Limits HER2+ Breast Cancer Tumorigenesis by Perturbing HER2 Trafficking and Promoting Release Via Small Extracellular Vesicles. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Primer1 of Her2 (Human): TGCTGGACATTGACGAGACAGAGT (fwd) This paper N/A Primer2 of Her2 (Human): AGCTCCCACACAGTCACACCATAA (rev) This paper N/A Primer1 of Her2 (GAPDH): CTCCTCCTGTTCGACAGTCAGC (fwd) This paper N/A Primer1 of Her2 (GAPDH): CCCAATACGACCAAATCCGTT (rev) This paper N/A Recombinant DNA DsRed-Rab7 Choudhury et al., |
